POTENTIAL OF ENTOMOPATOGEN FUNGi Aschersonia sp. AS A BIOPESTICIDE OF WHITEFLY ON CITRUS PLANT IN BALI INDONESIA

The occurrence of new diseases emerged in early 2014, in several orange-producing villages in Bangli Regency, which were found to be orange to yellowish orange fungus suspected to attack orange leaves. Community reports about the disease made the Faculty of Agriculture hammering the Rapid Reaction Team to survey and analyze the truth of the news. After the sample has been examined by a laboratory, it is suspected that the fungus is not a fungus that attacks plants but a fungus that attacks insects, namely entomopathogenic fungi of the genus Aschersonia sp. The fungus infects whitefly that attach to the orange leaves so as if it looks like a case to infect plants. Initial research has been carried out by calculating the percentage of Aschersonia sp. against whitefly in the field. Preliminary research results show the percentage of Aschersonia sp. in the villages of Kerta and Sekaan at 78.28% and 78.26%. The data is very interesting because the performance of the fungus is able to suppress whitefly with a high percentage exceeding 70%. Based on this, further research is needed about the fungus and its host insects. Aschersonia sp. has been identified in the Lab. Phytopathology  Faculty of Agriculture, Udayana University. To carry out research and can be used as a biopesticide, further research is needed as to the type of host insect and its attack mechanism. Host insects Aschersonia sp. based on preliminary observations found that there are 2 in citrus and mulberry plants of the whitefly species. The two host insects are very difficult to distinguish morphologically because they are very similar, so it is necessary to do deep identification both morphologically and molecularly. The results of these studies are expected to be able to prove scientifically about the types of host insects from Aschersonia sp. In this study, basic research is focused, namely identification as a basic research that is very useful to support the potential of the insect fungus Aschersonia sp. in controlling citrus planted vermin in Bali and Indonesia. The identification of whitefly, the host insect of Aschersonia sp. was conducted based on morphological and molecular identification. Morphological identification of whiteflies using puparia stage, begins with sample preparation by Slide Mounting Protocol. The target  mitochondrial cytochrome c oxidase subunit I (MT-COI) gen was successfully amplified by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The morphological recognition and sequence analysis was identified the species of whitefly is  Paraleyrodes minei.